KEGG   Clostridium perfringens SM101: CPR_0942Help
Entry
CPR_0942          CDS       T00379                                 

Definition
(GenBank) hypothetical protein
Organism
cpr  Clostridium perfringens SM101
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: Ureide_permease DUF4363 DUF3450 HemX DUF3584 Lebercilin TPR_MLP1_2 Med30 DUF4446 DUF745 DUF2730 ADIP Spc7 BRE1 Sec8_exocyst Phage_GPO TraF_2 Med9 Atg14 APG6 Vps51 RIC3 Seryl_tRNA_N OmpH DUF1664 DUF1189 FlaC_arch Fib_alpha DUF4279 IncA TBPIP DUF4140 DUF5320 Fzo_mitofusin Reo_sigmaC Ly49 Prominin Sec20 TMPIT DUF4349
Motif
Other DBs
NCBI-ProteinID: ABG86581
UniProt: Q0SUE1
Position
complement(1075683..1075973)
Genome map
AA seq 96 aa AA seqDB search
MKNTLKKILKFLLGICIFFIAICIGSSLKDDSNLNNTHNELVTTINNSKEDLTHKEEELS
KAKTEKEDLEKQLSTLNDSLNKTKESIKQLDHSTNN
NT seq 291 nt NT seq  +upstreamnt  +downstreamnt
atgaaaaatacactaaaaaaaatattaaaattcttattagggatatgtatattttttata
gctatttgtattggttcctcactaaaagatgattcaaatttaaataatactcataatgaa
ttagttaccacaattaacaattcaaaagaggatttaactcataaagaagaggaattgtct
aaggctaaaactgaaaaagaggatttagaaaaacaattaagtactctaaatgattcatta
aataaaactaaggaatctattaaacaattagatcatagcactaataattaa

DBGET integrated database retrieval system