KEGG   Clostridium perfringens SM101: CPR_0957Help
Entry
CPR_0957          CDS       T00379                                 

Definition
(GenBank) glycosyltransferase ycbB
Organism
cpr  Clostridium perfringens SM101
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: ABG86571
UniProt: Q0SUC7
Position
complement(1087779..1088192)
Genome map
AA seq 137 aa AA seqDB search
MAKYLNDMIKAIINENYDMVVGSRFINNSNYKPSIYRKLGINFFSSLVSILGRKKVFDTT
SGYRAVNNSVIKEFVEYYPKDYPEVETLSYIIRKGFKVKEIPVEMNYRESGKSSITPLKS
IYYMLKVTFATIISPDK
NT seq 414 nt NT seq  +upstreamnt  +downstreamnt
atggcaaaatatcttaatgatatgataaaagccataattaatgaaaattatgatatggta
gtaggctctagatttataaataatagcaattataagcctagtatctatagaaaattagga
ataaacttcttttcatcacttgtttcaattttaggtagaaaaaaagtttttgatactaca
tcaggatatagagctgtaaataactccgtaattaaggagtttgtagaatattatcctaaa
gattatccagaagtagaaacactatcatatattattagaaaagggtttaaagttaaagaa
attcctgttgaaatgaactatagagaatctggaaaatcttctataaccccactaaaatct
atttactatatgctaaaagtaacttttgcaactataatttcacctgataaataa

DBGET integrated database retrieval system