KEGG   Colwellia psychrerythraea: CPS_0862Help
Entry
CPS_0862          CDS       T00258                                 

Gene name
pqqA
Definition
(RefSeq) coenzyme PQQ biosynthesis protein A
  KO
K06135  pyrroloquinoline quinone biosynthesis protein A
Organism
cps  Colwellia psychrerythraea
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: PqqA
Motif
Other DBs
NCBI-ProteinID: AAZ25436
UniProt: Q488A4
Position
complement(877244..877315)
Genome map
AA seq 23 aa AA seqDB search
MWTKPKFEEMRLGFEVTLYISNR
NT seq 72 nt NT seq  +upstreamnt  +downstreamnt
atgtggactaaaccaaagtttgaagaaatgcgtttaggttttgaagtaacactttatatc
agcaacagataa

DBGET integrated database retrieval system