KEGG   Chlamydia psittaci CP3: B711_0794Help
Entry
B711_0794         CDS       T02251                                 

Gene name
fer1
Definition
(GenBank) ferredoxin
Organism
cpsc  Chlamydia psittaci CP3
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: AFS27187
Position
complement(789441..789821)
Genome map
AA seq 126 aa AA seqDB search
MNHNSLLVFSCPCCCEGEVSFSVFSLEEVLACSCCSSTYTFDPAMRNSIRQFAALCLRIY
EASPILGNAAVSVSVKDHAVEIPFQLLFSRFPVVFNLTLEGKQIAIRFIFDALKREVLHK
EKASLV
NT seq 381 nt NT seq  +upstreamnt  +downstreamnt
atgaaccataactcgttacttgttttttcctgtccctgctgttgcgaaggagaagtttct
ttttcggtatttagcttggaggaagtcttagcctgtagttgttgttcttctacatatact
ttcgacccagcaatgcgtaactctattcgtcaatttgctgcgttatgtctaaggatttac
gaggcctctcctatactaggaaatgctgcggtttctgtatccgtcaaagatcatgctgtg
gaaatacccttccagctactcttttctagattccccgtggtgtttaatttaactcttgaa
gggaaacagatcgctattcgttttatttttgatgctcttaaaagggaagttttacataaa
gaaaaagcatctttagtctaa

DBGET integrated database retrieval system