KEGG   Chlamydia psittaci CP3: B711_0880Help
Entry
B711_0880         tRNA      T02251                                 

Definition
(GenBank) tRNA-Ser
  KO
K14233  tRNA Ser
Organism
cpsc  Chlamydia psittaci CP3
Pathway
cpsc00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:cpsc00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    B711_0880
Non-coding RNAs [BR:cpsc03100]
 Transfer RNA
  tRNA
   B711_0880
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
complement(875983..876067)
Genome map
NT seq 85 nt NT seq  +upstreamnt  +downstreamnt
ggaagaatggcagagcggtttaatgcacctgtcttgaaaacaggagacctgaaagggtcc
gggggttcgaatccctcttcttccg

DBGET integrated database retrieval system