KEGG   Corynebacterium pseudotuberculosis FRC41: CPFRC_01045Help
Entry
CPFRC_01045       CDS       T01277                                 

Definition
(GenBank) DUF4177 domain-containing protein
Organism
cpu  Corynebacterium pseudotuberculosis FRC41
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: ADK27995
Position
215133..215288
Genome map
AA seq 51 aa AA seqDB search
MTKWEYATVPLLTHATKQILDTWGEDGWELVNVVPGPNPENVVAYMKREVE
NT seq 156 nt NT seq  +upstreamnt  +downstreamnt
atgactaaatgggaatatgccactgtgcctctgctaactcacgcgactaagcagattttg
gatacctggggcgaggacggctgggagctggttaacgttgtgccggggccaaatcctgag
aacgttgttgcttatatgaagcgtgaggttgagtaa

DBGET integrated database retrieval system