KEGG   Curtobacterium sp. BH-2-1-1: BJK06_08815Help
Entry
BJK06_08815       CDS       T04562                                 

Definition
(GenBank) N-acetylglucosamine-6-phosphate deacetylase
  KO
K01443  N-acetylglucosamine-6-phosphate deacetylase [EC:3.5.1.25]
Organism
cub  Curtobacterium sp. BH-2-1-1
Pathway
cub00520  Amino sugar and nucleotide sugar metabolism
cub01100  Metabolic pathways
cub01130  Biosynthesis of antibiotics
Brite
KEGG Orthology (KO) [BR:cub00001]
 09100 Metabolism
  09101 Carbohydrate metabolism
   00520 Amino sugar and nucleotide sugar metabolism
    BJK06_08815
Enzymes [BR:cub01000]
 3. Hydrolases
  3.5  Acting on carbon-nitrogen bonds, other than peptide bonds
   3.5.1  In linear amides
    3.5.1.25  N-acetylglucosamine-6-phosphate deacetylase
     BJK06_08815
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: Amidohydro_1
Motif
Other DBs
NCBI-ProteinID: AOX65842
Position
complement(1853181..1854329)
Genome map
AA seq 382 aa AA seqDB search
MSTLVRARRILTATHDLHDGWLAVDDAGTVLESGSGTPPRTDTAVTIEGTLLPGAVDLHA
HGALGHDFATATTDGAALAAGHHRARGTTSLIASVATGPVAETRAALGRLRVLVAEGTLA
GLHLEGPWLSPARRGAHRSDLLHAPDPAELDDFLTAADGALRIVTLAPELPGAIDAVGRL
VDAGVVVAIGHTDASADETRAAIDAGATLVTHLFNGMPPLHHRRPGPVGVALTDDRVLVE
CIVDGHHLDPAAVELVRRAAPDRLVLVSDAMAATGCGDGEHAIAGSAVSVRDGVALLTDG
SSLAGSTITVRDAARRLLDGGTPLPEVVAATSARPARLLGLPAPLSVGAPADLLVIDEGP
SSAARSEPWRVLDLRTTAAVHR
NT seq 1149 nt NT seq  +upstreamnt  +downstreamnt
atgagcaccctggtgcgtgcgcggcggatcctcaccgcgacgcacgacctccacgacggg
tggttggcggtcgacgacgccggtacggtcctcgagagcggatccgggacgcccccgcgg
accgacaccgcggtgacgatcgagggaacgctgctgccgggggcggtcgacctgcacgcc
cacggggcgctcgggcacgacttcgccacggccacgacggacggtgccgcgctcgctgcg
ggccaccaccgcgcacgcgggacgacgtcgctcatcgcgtccgtcgcgacgggcccggtc
gccgagacgcgcgcagcactcggacgcctccgtgtcctcgtcgccgagggcacgctcgcc
gggctccacctcgagggaccgtggctgtcacccgcgcgccgcggtgcccaccggtcggac
ctcctgcacgcaccggacccggcggagctcgacgacttcctcacagcggcggacggcgcg
ctccggatcgtcacgctcgcaccggaactccccggagcgatcgacgccgtgggccgcctc
gtcgacgccggcgtcgtcgtcgcgatcggccacaccgatgcctccgccgacgagacgcgc
gcagcgatcgacgccggtgccaccctcgtcacgcacctcttcaacggcatgcctccactg
caccaccgacggccgggcccggtcggcgtcgccctgaccgacgaccgtgtcctggtcgag
tgcatcgtcgacgggcaccacctcgatcccgcggcggtcgaactcgtgcggcgagccgcg
ccggaccgcctcgtgctcgtctcggacgcgatggccgccacgggctgcggcgacggcgag
cacgcgatcgcgggttcggcggtctcggtccgtgacggcgtcgcgctgctcaccgacggc
tcgtccctcgccggcagcaccatcaccgtgcgggacgccgcccgacgcctcctcgacggt
ggcaccccgctgcccgaggtcgtcgcggcgacgtcggcgcgaccggcacgcctgctcggc
ctcccggcgccgctctcggtcggcgctcccgccgacctgctcgtgatcgacgagggcccc
agcagtgccgcgcggtcggagccctggcgcgtcctcgacctgcggacgaccgcggcggtg
caccggtga

DBGET integrated database retrieval system