KEGG   Conexibacter woesei: Cwoe_4931Help
Entry
Cwoe_4931         gene      T01153                                 

Definition
(GenBank) pseudogene
Organism
cwo  Conexibacter woesei
SSDB OrthologParalogGene clusterGFIT
Position
complement(5258826..5259647)
Genome map
NT seq 822 nt NT seq  +upstreamnt  +downstreamnt
tgcgccgacaccgcgcccgcaacgcccggcgaccgccagttcccctacgtcggcaaggtt
ctgcgggagctgacgctgagacagctgaagacgctcgactgcggctccaagacgctgccg
tcgctgccgagacaggaggcggcgcccggcgagcggatcccgacgctcgcggaggtgatc
gcgctcgtgcgccgcagcgaccgcgacgacgtgcggctcaacgtcgagacgaagctgtcg
ccgctggcgccgtacgagggcgccgagccgcgcgagcacgcgcggctgctcgtcgacgag
ctgcggcgcggccggatgctcgaccgcgcgacgatccagtcgttcgactggcgcacgatc
gtcgccgcgcggcggctcgaccgtcgcgtccagaccgtcgcgctcgtgtggcagtacggc
ccggcggagtgcgcgacgctcgccgacgagtgctcgctgaaggcgctgttcggcgacgcg
tcggtgaagagcccgtggaccgccggcctcgactggtggaaggaccaggacctcggtcgc
ctcgtgcggcgcagcggagccgcgaccgtctcggccaactggcaggtgcacgaccccgcg
caggtcgccgcgccgaacgacgactggtacctgcgcaccgacccgtcctacttccacggg
ccggacgtcgagggcctgcaccggcaggggctggcggtcgtgccgtacacgctgaacgac
cccgcgacgatccagcgcgcgatcgacctcggcgtcgacgggatcatcagcgacgatccg
ctgacgctgatcgcggtggcgacgcgcaacgggctgcgctga

DBGET integrated database retrieval system