KEGG   Conexibacter woesei: Cwoe_4935Help
Entry
Cwoe_4935         CDS       T01153                                 

Definition
(GenBank) hypothetical protein
Organism
cwo  Conexibacter woesei
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: ADB53346
UniProt: D3FC51
Position
5264105..5264587
Genome map
AA seq 160 aa AA seqDB search
MAFVVARPHGRWEARESFTTASGPRSRTLASFDVLTEEVAAHASARSSRGATPAEVRAAA
RKAGAPVAPHAADRAASDLLDAIARGDLPRPALRRVLVDALAGEVVAPPTDSELAAAAWV
DRTPRERADALHDLLLLADHLPEPRRRTARRFPRLASGPA
NT seq 483 nt NT seq  +upstreamnt  +downstreamnt
atggcattcgtcgtcgcccgtccacacggccggtgggaggcccgcgagtcgttcacgacc
gcgtcgggcccgcgcagccggacgctcgcgagcttcgacgtcctcaccgaggaggtcgca
gcgcacgcgagcgcacgctcgtcccgcggagcgacacccgccgaggtgcgcgccgccgct
cgcaaggcgggcgcacccgtcgcgccgcacgcggcggaccgcgccgcctccgacctgctc
gacgcgatcgcgcgcggggacctgccgcgacccgcgctgcgccgggtgctcgtggacgcg
ttggccggggaggtcgtcgcgccgccgaccgacagcgagttggcggcggccgcgtgggtc
gaccgaacgccgcgcgaacgtgccgacgcgctgcacgacctcctgctgctcgccgatcac
ctgccggagccccgccgtcgaacggcgcgaagattcccgcggctggcctcaggccccgca
tga

DBGET integrated database retrieval system