KEGG   Delftia acidovorans: Daci_5842Help
Entry
Daci_5842         CDS       T00620                                 

Definition
(GenBank) plasmid stability protein StbC
  KO
K21495  antitoxin FitA
Organism
dac  Delftia acidovorans
Brite
KEGG Orthology (KO) [BR:dac00001]
 09180 Brite Hierarchies
  09183 Protein families: signaling and cellular processes
   02048 Prokaryotic defense system [BR:dac02048]
    Daci_5842
Prokaryotic defense system [BR:dac02048]
 Toxin-antitoxin system (TA system)
  Type II TA system
   FitB-FitA
    Daci_5842
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: Arc
Motif
Other DBs
NCBI-ProteinID: ABX38470
UniProt: A9C107
Position
complement(6497635..6497892)
Genome map
AA seq 85 aa AA seqDB search
MANVTVRNLPDAVHRALRVRAAHHGRSTEAEIRDILEAAVRPEERVRLGSMLASIAREAG
GLTDSEAEGFNRLRDRAPAEPMDFE
NT seq 258 nt NT seq  +upstreamnt  +downstreamnt
atggccaatgtgactgtgagaaacctgcccgatgccgtgcaccgggccttgcgggtacgc
gctgcccaccatggccgcagtacggaggcggaaatccgcgacattctggaagccgccgtc
cggccggaagagcgtgtcaggctcggctccatgctggcgtccattgcccgcgaggcagga
ggactgaccgactccgaagccgagggcttcaaccgcctgcgcgacagggcgccagccgag
cccatggactttgaatga

DBGET integrated database retrieval system