KEGG   Dechloromonas aromatica: Daro_2190Help
Entry
Daro_2190         CDS       T00259                                 

Definition
(GenBank) PAAR protein
Organism
dar  Dechloromonas aromatica
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: PAAR_motif
Motif
Other DBs
NCBI-ProteinID: AAZ46929
UniProt: Q47E02
Position
complement(2367853..2368119)
Genome map
AA seq 88 aa AA seqDB search
MSRPFILLGDKTDHGGVVITASESSDCNGKGVARVGDQVTCPKRGHGNVTTIVTGDSTAL
IDGRPAARHGDKTACGAILIASQSLTTD
NT seq 267 nt NT seq  +upstreamnt  +downstreamnt
atgagcagacctttcattctattgggcgacaagacggatcacggcggggtggtaatcacc
gcatccgaatcgagcgactgcaacggaaagggcgtggcccgggttggtgatcaggtgacc
tgcccgaagcgtggtcatggcaacgtaacgaccattgttaccggagattccacggcgctg
attgatggacgcccggcggctcgtcatggggacaaaactgcttgtggtgcgatattgatc
gccagccaatcgttgacaactgattaa

DBGET integrated database retrieval system