KEGG   Dyadobacter fermentans: Dfer_R0033Help
Entry
Dfer_R0033        tRNA      T00970                                 

Definition
(GenBank) tRNA-Val
  KO
K14237  tRNA Val
Organism
dfe  Dyadobacter fermentans
Pathway
dfe00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:dfe00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Dfer_R0033
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:dfe03100]
    Dfer_R0033
Non-coding RNAs [BR:dfe03100]
 Transfer RNA
  tRNA
   Dfer_R0033
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
4876383..4876460
Genome map
NT seq 78 nt NT seq  +upstreamnt  +downstreamnt
gggagtttagctcagttggttcagagcatctgccttacaagcagagggtcgggggttcga
atccctcaactcccacga

DBGET integrated database retrieval system