KEGG   Acidovorax ebreus: Dtpsy_1183
Entry
Dtpsy_1183        gene      T00853                                 

Definition
(GenBank) pseudogene
Organism
dia  Acidovorax ebreus
SSDB
Position
1241387..1241748
NT seq 362 nt   +upstreamnt  +downstreamnt
cgtatgggttcttcccgcgcaacttgcgcagacgggtatgggtggtcgcttctgcagcga
gccggtgtgccgaacagctcaggcacggcgagagccatgcagtccaaccttggtcgccgg
gaggcgctaacgacgacaggcgtctgccgccagacaacaaccgcgtcgagaggcaaattc
gtccagtggcacttcaaagggcgaaccagttgttcgtcggtagcttgcgtgccggtcagc
gcgctgtttcggtgatgagcctggtgcgctcggctcggcccaacgggcatgacctctatg
cggacttgcgtgacgtgctcgaatgcctttcgacgcagctagccaagcatatggaaaggt
ga

DBGET integrated database retrieval system