KEGG   Acidovorax ebreus: Dtpsy_1194
Entry
Dtpsy_1194        gene      T00853                                 

Definition
(GenBank) pseudogene
Organism
dia  Acidovorax ebreus
SSDB
Position
1255087..1255827
NT seq 741 nt   +upstreamnt  +downstreamnt
atgtccaacctcacccccgtcatcaaatccatccaagacatcatgcgccaggactctggc
gtggatggcgacgcgcagcgcatcagccagctcacctggctgctgttcctcaaggtgttt
gacgcgctggaagaagaactcgaactcacccgcgacgactaccaaagccccatcgccgag
cctctgcgttggcgcaactgggcggccaatgcggaagggatcaccggcaaggagttgctc
gacttcatcgaccaggatctcttccccgccctcaagggcctgagcgccgatccacaacgc
aacccgcgcggctacgtggtgcgcggcgtgtttgaagacgcctacaactacatgaaaagc
ggccacctactgcgtcaggtggtcaacaagctcaacgccatcgacttcaaccgccaggcc
gaacgccaccagttcaacgacctgtacgaaaagatcctgcgcgacctgcaaagcgcaggc
aacgcgggcgagttctacaccccccgcgccgtcacccaattcatggtggacatgaccaac
ccccagctgggcgaaagcgtgatggaccccgccaccggcaccggcggcttcctcgtctgc
gccatcgagcacctgcgcaaacaggtgcacaacgccgaccaagaagccgtgctgcaaaac
agcattcgcggcgtcgagaaaaagcagctcccgcacatgctgtgcgtcaccaacctgctg
ctgcacggcattgatcagcct

DBGET integrated database retrieval system