KEGG   Acidovorax ebreus: Dtpsy_1195
Entry
Dtpsy_1195        gene      T00853                                 

Definition
(GenBank) pseudogene
Organism
dia  Acidovorax ebreus
SSDB
Position
1255838..1256155
NT seq 318 nt   +upstreamnt  +downstreamnt
gagcttgctgagtatcgattgatgccaggagatttgcttatttgtgaaggcgggtatcct
gggcgctgtgcaatatggcgtgaccccgatcgcgagatgtactttcaaaaggcgctgcac
cgggtccgtccacgaggtggcattgcggttgaattaatcgcaattgctttggagtcagat
tcaagagctgggaacctagacaaacacttcacaggggccacgatcaagcactttgttgga
caggcgcttgatcggtacgtgcttgcgcttcccccactcgccgaacaatcccgcatcgtc
acccgcgtcaccgccctg

DBGET integrated database retrieval system