KEGG   Acidovorax ebreus: Dtpsy_1197
Entry
Dtpsy_1197        gene      T00853                                 

Definition
(GenBank) pseudogene
Organism
dia  Acidovorax ebreus
SSDB
Position
1256773..1257153
NT seq 381 nt   +upstreamnt  +downstreamnt
cacctgtcgcgcagcgggaaatcgaagacggccgagtcagcgctggagcaggccctgatc
gcgcgcttcgccacgctgggccgagtacccgagccgttcctgctgcgttcggacaatgag
ttggtcttcaccagccgcagcttcacggccctgggaagctacggactgcgtcaagaattc
atcacgccgcacagccctgagcagaacggtctggtcgagcgggtgatccgcacgctcaag
tgcgtgcatcggcatcgcttcgactcgctgcagcatgccagtcgcctgatcggggactgg
atccatttctacaaccaccggcgcccgcaccaggcgctgaacatgagaacccccgctgag
gcattcgcattagcggcatga

DBGET integrated database retrieval system