KEGG   Acidovorax ebreus: Dtpsy_1204
Entry
Dtpsy_1204        gene      T00853                                 

Definition
(GenBank) pseudogene
Organism
dia  Acidovorax ebreus
SSDB
Position
complement(1268059..1269302)
NT seq 1244 nt   +upstreamnt  +downstreamnt
atgcattcccacagcacgccgcccgcagctgccccacacgggcagcaccggcaccacagc
ccccacgtgccccggccatcggccgctccacccgacccaccacccgccgacacggtctac
acctgccccatgcacccgcaggtgcgacagagcggccccggccactgccccaagtgcggc
atggcgctggagccggtactgcccagcctggacgcggccgatgacaaccccgcactgcgc
gacttctcgcgccgcttctggtggacgctgccgctcaccatggtcgtcaccacgctggcc
atggccgggcaccggctgggttgggtcggcatggccacgcaaagcggggtggagctggtg
ctgacgctgcccatcgtgctatgggccggcgcgccgttcttcgtacgcgactggcagtcc
gtggtgcagcgcagccccaacatgtggccggctggggcgaggcagaggtgctgcgcctgg
ccgccagcctggaccagggcagcgagcatccgctagcggcggccatcgtcgctgcggcac
gccagcaggggctggcgctggacgcggccgagcagttcgactcggcctcgggcatcggcg
tgcgcggccggatcgcgggccgcaccttggcgctgggtaacacggtgctgatgcagcagt
ccagcgtgaatacgggaccgctggcgcagaccgctgaggcactgcgcggcgaaggcgcca
gcgtgatgttcctggccatagatgggcaactggcgggcctgctggccgtctccgacccca
tcaaggccagcacgcccgacgcgctggccgccctgcatgcggccggcctgcgcatcatca
tggccaccggcgatggcctgaccacggcaggtgccgtgggacggcgcctgggcatcgacg
aggtgcacggcgaggtattgcccgccgataagctggccctggtcgaacgcctgcaggccg
agggacgcaccgtggccatggccggcgacggcatcaacgacgcacccgcgctcgcacgcg
ccgacgtgggcatcgccatgggcacggacgtggccatgaacagcgcgcaactcacgctgg
tcaagggcgacctgcgcggcatcgccacggcgcgcgcgctgtcgcaggccacggtggcca
acatgcgccaaaacctgggctttgccttcgtctacaacgcgctgggcgtgccgctggccg
ccgggctgctctacccgttcacgggctggctgtgtcgccgatga

DBGET integrated database retrieval system