KEGG   Acidovorax ebreus: Dtpsy_R0021
Entry
Dtpsy_R0021       tRNA      T00853                                 

Definition
(GenBank) tRNA-Leu
  KO
K14228  tRNA Leu
Organism
dia  Acidovorax ebreus
Pathway
dia00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:dia00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Dtpsy_R0021
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:dia03100]
    Dtpsy_R0021
Non-coding RNAs [BR:dia03100]
 Transfer RNA
  Dtpsy_R0021
SSDB
Position
1242102..1242193
NT seq 92 nt   +upstreamnt  +downstreamnt
gccccgatggtgaaattggtagacactgcggacttaaaatccgccgcttcctgagaaggg
gcgtgccggttcgaccccggctcggggcacca

DBGET integrated database retrieval system