KEGG   Drosophila melanogaster (fruit fly): Dmel_CG9470Help
Entry
Dmel_CG9470       CDS       T00030                                 

Gene name
MtnA
Definition
(RefSeq) metallothionein A, isoform B
Organism
dme  Drosophila melanogaster (fruit fly)
SSDB OrthologParalogGFIT
Motif
Pfam: Metallothio_5 Metallothio_Euk
Motif
Other DBs
NCBI-GeneID: 41202
NCBI-ProteinID: NP_001262438
FlyBase: FBgn0002868
UniProt: P04357 A0A0B4KFM8
Position
3R
AA seq 40 aa AA seqDB search
MPCPCGSGCKCASQATKGSCNCGSDCKCGGDKKSACGCSE
NT seq 123 nt NT seq  +upstreamnt  +downstreamnt
atgccttgcccatgcggaagcggatgcaaatgcgccagccaggccaccaagggatcctgc
aactgcggatctgactgcaagtgcggcggcgacaagaaatccgcctgcggctgctccgag
tga

DBGET integrated database retrieval system