KEGG   Oryza sativa japonica (Japanese rice) (RAPDB): Os05t0356201-00Help
Entry
Os05t0356201-00   CDS       T02163                                 

Gene name
Os05g0356201, AP2/EREBP92, APETALA2/ETHYLENE-RESPONSIVE_ELEMENT_BINDING_PROTEIN_92
Definition
(RAP-DB) Similar to LIPLESS2.
Organism
dosa  Oryza sativa japonica (Japanese rice) (RAPDB)
SSDB OrthologParalogGFIT
Other DBs
RAP-DB: Os05t0356201-00
Position
chr05:complement(16885866..16886372)
AA seq 168 aa AA seqDB search
MVWRRGGGGLGAGGRRDAQSDAGRGRAARSTAASSSTAAPGDGNRTYGKPPRLLLVLSIF
ESSTKEEGGERGKGSKRRAAWTGLVLDSSCFGHFSLLLLLPLFFCSFPNRRTYDLAAIKF
RGVEGWRPTSISAWRIMGDDLKQVRTSLTRSLWMSNLTKEEFVHVLRR
NT seq 507 nt NT seq  +upstreamnt  +downstreamnt
atggtgtggcgacgtggtggcggcgggctgggcgcaggcgggcgacgcgacgcccaatcc
gacgcgggccgcggtcgcgcagctcgcagtactgcggcgtcaagttctaccgccgcaccg
ggcgatgggaatcgcacatatggtaagcctcctcgtctcctgctcgttctttccattttc
gagagctcaacgaaggaggaaggaggagagagaggcaaggggagcaaaagaagagcagca
tggacgggtttggtattggattcgtcttgttttgggcatttctcgcttctgctcctttta
cctttgtttttctgctcctttcccaatcgcaggacgtacgatctagcggcgatcaagttc
cgcggcgtggagggctggaggccgacatcaatttcagcttggaggattatgggggatgat
ctgaagcaggtgagaacaagtttaacgagatcattgtggatgagcaatctgaccaaggag
gagttcgtccacgtgctccggcggtag

DBGET integrated database retrieval system