KEGG   Oryza sativa japonica (Japanese rice) (RAPDB): Os06t0597400-00
Entry
Os06t0597400-00   CDS       T02163                                 

Gene name
Os06g0597400, PINHEAD_1, PNH1
Definition
(RAP-DB) Similar to Protein argonaute PNH1.
Organism
dosa  Oryza sativa japonica (Japanese rice) (RAPDB)
SSDB
Other DBs
RAP-DB: Os06t0597400-00
Oryzabase: 3035
Position
chr06:23546863..23546928
AA seq 21 aa
GTSVKPLPAVKEKVKRVMFYC
NT seq 66 nt   +upstreamnt  +downstreamnt
ggaacctcggtgaagccattgcctgcggtgaaggagaaggtgaagagggtgatgttctac
tgttga

DBGET integrated database retrieval system