KEGG   Deinococcus radiodurans: DR_2124
Entry
DR_2124           CDS       T00025                                 

Gene name
rpmJ
Definition
(RefSeq) 50S ribosomal protein L36
  KO
K02919  large subunit ribosomal protein L36
Organism
dra  Deinococcus radiodurans
Pathway
dra03010  Ribosome
Brite
KEGG Orthology (KO) [BR:dra00001]
 09120 Genetic Information Processing
  09122 Translation
   03010 Ribosome
    DR_2124 (rpmJ)
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03011 Ribosome [BR:dra03011]
    DR_2124 (rpmJ)
Ribosome [BR:dra03011]
 Ribosomal proteins
  Mitochondria/ Chloroplast
   Large subunit
    DR_2124 (rpmJ)
  Bacteria
    DR_2124 (rpmJ)
SSDB
Motif
Pfam: Ribosomal_L36
Other DBs
NCBI-GeneID: 1799730
NCBI-ProteinID: NP_295847
UniProt: Q9RSK0
Structure
PDB: 

Position
1:2129426..2129539
AA seq 37 aa
MKVRSSVKKMCDNCKVVRRHGRVLVICSNVKHKQRQG
NT seq 114 nt   +upstreamnt  +downstreamnt
atgaaagttcgtagcagtgtcaagaaaatgtgcgacaactgcaaagtggtccgccgccat
ggtcgcgtgctggtcatttgctccaacgtcaagcacaagcagaggcagggttaa

DBGET integrated database retrieval system