KEGG   Escherichia coli B REL606: ECB_01689Help
Entry
ECB_01689         gene      T00944                                 

Gene name
arpB
Definition
(GenBank) pseudogene
Organism
ebr  Escherichia coli B REL606
SSDB OrthologParalogGene clusterGFIT
Position
1780359..1782258
Genome map
NT seq 1900 nt NT seq  +upstreamnt  +downstreamnt
atgagtcaaaacgatatcattatcagaactcattataagtctcctcatagattgcacatc
gatagcgacataccaacaccttcatcagagcctattaatcaatttgcgcgccagctcatc
accctacttgatacctctgacttaagttcgatgctgtcatactgtgttactcaggaattt
accgcaaactgtcgaaaaatatcacaaaattgttattccactgccctttttaccattaac
tttgccacttcacccatccatacagaaaatatactcattacattacactataaaaaagaa
atcatttccttattactggaaaccacgcctattaaagctaaccatttgcgaagcatactg
gattatattgaacaggaacagttaactgctgaagatcgtaaccattgtatgaaactgtct
aaaaaaatccatagagaaaaaaactatacacccaacagtaaatctcaatggtagtgcatg
ttttttgcaatctccttctgacgctattttttgtcgccatctgtcattgcaatacgccct
tgattcattgagaaatggaaaaggcaaagtcaacctgattaaacattactcctccgttga
atccatacagcagcatgtccccttagtccgggacgcggagttcagagcattacttcgcca
tcctcctgcagggagtcgcgttatcgcgagtaaggattttggcttcgctttagatatttt
cttttgtcgaatgatggcaaacaatgtcagtcatatgtccgcgattttatatatagacaa
tcatactttgtcagtaaggctacgaataaagcagtcagtgtatggacaattaaattatgt
tgtgtccgtttacgacccgaacgataccaacgttgccgtcagagacatccacaggacagc
acggggctttctttcgcttgataagttcatcagttcaggtcccgatgctcagacctgggc
tgatagatatgttcgcaactgtgcaattgctattctgcccctattacctgtgggagttcc
aggggctattttcgcgggtattgcatcacgaatgccatttgcccctatacatccatcggc
aatgttgttaataatggctacaggccagactcaacagcttattacattattcaaacagtt
gcccatactccctgaaaaagaaatcattgaaataataactgcgcagaatagcgttggtac
acctgctttatttttggctatgatgaacggacatactgacaacgtgaaaatatttataca
agaaattcagtcactggtagataatcacatcattcatgaagataatctggttaaattact
gcaaactaaaagtgctaacgaaacacctggactttatatctccatgttgtatggattcga
tgaaataatcgatatctttctgaatgcattaaccactccaatagcacaagagcttttaaa
caaaaaactggtgatgagtattttagccatgaaaatacatgatggtgagccaggattata
cgccgcaatggaaaataatcaccctttgtgtgtcacacggttcctctctaaaattaatgg
catcgcctttaaatacaagttgagcaaagctaacatcatggatttattaaaaggagctac
agcacagggaacccctgcattatacatcgccatgagcaagggtaatgaagacgtcgtgtt
atcttatatatcgacgctgggtgcttttgcaaaaaaacattcttttagtcaacatcagtt
atttacactattggccgctaaaaatcatgacaacatgtcagctgttcatatagccattca
tcataagcattataaaactgtagaaacatattatgctgctattaatgcaatcagccaaag
cctgagttttagtgctgatgaaataaagacgtatttataa

DBGET integrated database retrieval system