KEGG   Escherichia coli O157 H7 EC4115 (EHEC): ECH74115_5038Help
Entry
ECH74115_5038     gene      T00778                                 

Definition
(GenBank) pseudogene
Organism
ecf  Escherichia coli O157:H7 EC4115 (EHEC)
SSDB OrthologParalogGene clusterGFIT
Position
4687784..4687981
Genome map
NT seq 198 nt NT seq  +upstreamnt  +downstreamnt
atgacatcattaaccccggaagcagcactggatattctgattgcgtggctgcaggacaat
atcgacagcgaatccggaattatcttcgacaacgatgaggataaaacggattcggcagca
ttgttgccctgtatcgaacaggtcagggaagatgtccgtaccctgcgccaactgcagctt
ctgcaacagaaccggtga

DBGET integrated database retrieval system