KEGG   Escherichia coli K-12 W3110: JW1667Help
Entry
JW1667            CDS       T00068                                 

Gene name
lpp
Definition
(GenBank) murein lipoprotein
  KO
K06078  murein lipoprotein
Organism
ecj  Escherichia coli K-12 W3110
Brite
KEGG Orthology (KO) [BR:ecj00001]
 09180 Brite Hierarchies
  09181 Protein families: metabolism
   01011 Peptidoglycan biosynthesis and degradation proteins [BR:ecj01011]
    JW1667 (lpp)
Peptidoglycan biosynthesis and degradation proteins [BR:ecj01011]
 Peptidoglycan biosynthesis and degradation
  Structural protein
   JW1667 (lpp)
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: LPP JIP_LZII Alanine_zipper MctB DUF948 DUF4763 DivIC EzrA TMF_DNA_bd DUF1664 ADIP ZapB Cluap1 CLZ DUF16 YscO NPV_P10 COG6 TraF_2 Tropomyosin_1 TPR_MLP1_2 EspB_PE Atg14 DUF3138 COG5 TolA_bind_tri COG2 FlaC_arch Med4 Jnk-SapK_ap_N AKNA MbeD_MobD SlyX XhlA
Motif
Other DBs
NCBI-ProteinID: BAA16044
UniProt: P69776
Structure
PDB: 

Position
1759135..1759371
Genome map
AA seq 78 aa AA seqDB search
MKATKLVLGAVILGSTLLAGCSSNAKIDQLSSDVQTLNAKVDQLSNDVNAMRSDVQAAKD
DAARANQRLDNMATKYRK
NT seq 237 nt NT seq  +upstreamnt  +downstreamnt
atgaaagctactaaactggtactgggcgcggtaatcctgggttctactctgctggcaggt
tgctccagcaacgctaaaatcgatcagctgtcttctgacgttcagactctgaacgctaaa
gttgaccagctgagcaacgacgtgaacgcaatgcgttccgacgttcaggctgctaaagat
gacgcagctcgtgctaaccagcgtctggacaacatggctactaaataccgcaagtaa

DBGET integrated database retrieval system