KEGG   Escherichia coli K-12 MG1655: b1677Help
Entry
b1677             CDS       T00007                                 

Gene name
lpp
Definition
(RefSeq) murein lipoprotein
  KO
K06078  murein lipoprotein
Organism
eco  Escherichia coli K-12 MG1655
Brite
KEGG Orthology (KO) [BR:eco00001]
 09180 Brite Hierarchies
  09181 Protein families: metabolism
   01011 Peptidoglycan biosynthesis and degradation proteins [BR:eco01011]
    b1677 (lpp)
Peptidoglycan biosynthesis and degradation proteins [BR:eco01011]
 Peptidoglycan biosynthesis and degradation
  Structural protein
   b1677 (lpp)
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: LPP JIP_LZII Alanine_zipper MctB DUF948 DUF4763 DivIC EzrA TMF_DNA_bd DUF1664 ADIP ZapB Cluap1 CLZ DUF16 YscO NPV_P10 COG6 TraF_2 Tropomyosin_1 TPR_MLP1_2 EspB_PE Atg14 DUF3138 COG5 TolA_bind_tri COG2 FlaC_arch Med4 Jnk-SapK_ap_N AKNA MbeD_MobD SlyX XhlA
Motif
Other DBs
NCBI-GeneID: 946175
NCBI-ProteinID: NP_416192
Pasteur: lpp
RegulonDB: ECK120000537
ECOCYC: EG10544
ASAP: ABE-0005603
UniProt: P69776 A0A387D156
Structure
PDB: 

Position
1757421..1757657
Genome map
AA seq 78 aa AA seqDB search
MKATKLVLGAVILGSTLLAGCSSNAKIDQLSSDVQTLNAKVDQLSNDVNAMRSDVQAAKD
DAARANQRLDNMATKYRK
NT seq 237 nt NT seq  +upstreamnt  +downstreamnt
atgaaagctactaaactggtactgggcgcggtaatcctgggttctactctgctggcaggt
tgctccagcaacgctaaaatcgatcagctgtcttctgacgttcagactctgaacgctaaa
gttgaccagctgagcaacgacgtgaacgcaatgcgttccgacgttcaggctgctaaagat
gacgcagctcgtgctaaccagcgtctggacaacatggctactaaataccgcaagtaa

DBGET integrated database retrieval system