KEGG   Escherichia coli K-12 MG1655: b3969Help
Entry
b3969             tRNA      T00007                                 

Gene name
gltT
Definition
(RefSeq) tRNA-Glu
  KO
K14224  tRNA Glu
Organism
eco  Escherichia coli K-12 MG1655
Pathway
eco00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:eco00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    b3969 (gltT)
Non-coding RNAs [BR:eco03100]
 Transfer RNA
  tRNA
   b3969 (gltT)
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 948465
Pasteur: gltT
RegulonDB: ECK120002474
ECOCYC: EG30032
ASAP: ABE-0012993
Position
4168372..4168447
Genome map
NT seq 76 nt NT seq  +upstreamnt  +downstreamnt
gtccccttcgtctagaggcccaggacaccgccctttcacggcggtaacaggggttcgaat
cccctaggggacgcca

DBGET integrated database retrieval system