KEGG   Escherichia coli K-12 MG1655: b4407Help
Entry
b4407             CDS       T00007                                 

Gene name
thiS
Definition
(RefSeq) immediate sulfur donor in thiazole formation
  KO
K03154  sulfur carrier protein
Organism
eco  Escherichia coli K-12 MG1655
Pathway
eco04122  Sulfur relay system
Brite
KEGG Orthology (KO) [BR:eco00001]
 09120 Genetic Information Processing
  09123 Folding, sorting and degradation
   04122 Sulfur relay system
    b4407 (thiS)
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: ThiS ThiS-like
Motif
Other DBs
NCBI-GeneID: 2847702
NCBI-ProteinID: YP_026279
Pasteur: thiS
RegulonDB: ECK120002671
ECOCYC: G1
ASAP: ABE-0023907
UniProt: O32583
Structure
PDB: 

Position
complement(4192637..4192837)
Genome map
AA seq 66 aa AA seqDB search
MQILFNDQAMQCAAGQTVHELLEQLDQRQAGAALAINQQIVPREQWAQHIVQDGDQILLF
QVIAGG
NT seq 201 nt NT seq  +upstreamnt  +downstreamnt
atgcagatcctgtttaacgatcaagcgatgcagtgcgccgccgggcaaactgttcacgaa
ctactggagcaactcgaccaacgacaagcgggcgcggctctggcgattaatcagcaaatc
gtcccgcgtgagcagtgggcgcaacatatcgtgcaggatggcgaccagatcctgcttttt
caggttattgcagggggttga

DBGET integrated database retrieval system