KEGG   Escherichia coli K-12 MG1655: b4439Help
Entry
b4439             ncRNA     T00007                                 

Gene name
micF
Definition
(RefSeq) sRNA antisense regulator affecting ompF expression, Hfq-dependent
  KO
K18513  small regulatory RNA MicF
Organism
eco  Escherichia coli K-12 MG1655
Module
eco_M00746  Multidrug resistance, repression of porin OmpF
Brite
KEGG Orthology (KO) [BR:eco00001]
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03019 Messenger RNA Biogenesis [BR:eco03019]
    b4439 (micF)
  09183 Protein families: signaling and cellular processes
   01504 Antimicrobial resistance genes [BR:eco01504]
    b4439 (micF)
  09184 RNA family
   03100 Non-coding RNAs [BR:eco03100]
    b4439 (micF)
Messenger RNA biogenesis [BR:eco03019]
 Prokaryotic Type
  Bacterial mRNA degradation factors
   Other RNA degradation factors
    Bacterial Small RNA Regulators
     b4439 (micF)
Antimicrobial resistance genes [BR:eco01504]
 Gene sets
  Multipdrug resistance modules
   Multidrug resistance, repression of porin OmpF [MD:M00746]
    b4439 (micF)
Non-coding RNAs [BR:eco03100]
 Other RNA
  Unclassified
   b4439 (micF)
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 2847742
RegulonDB: ECK120002505
ECOCYC: EG30063
ASAP: ABE-0047259
Position
2313084..2313176
Genome map
NT seq 93 nt NT seq  +upstreamnt  +downstreamnt
gctatcatcattaactttatttattaccgtcattcatttctgaatgtctgtttaccccta
tttcaaccggatgcctcgcattcggtttttttt

DBGET integrated database retrieval system