KEGG   Escherichia coli O9 HS (commensal): EcHS_A0246
Entry
EcHS_A0246        gene      T00591                                 

Definition
(GenBank) pseudogene
Organism
ecx  Escherichia coli O9 HS (commensal)
SSDB
Position
267799..268935
NT seq 1137 nt   +upstreamnt  +downstreamnt
atggaacttaaaaaattgatggaacatatttctattattcccgattacagataagcctgg
aaagtagagcataaattgtcaggcatcctactattgactatttttgccgttatttctggt
gcagaaagttgggaagatatagaggatttcggggaaacacatctcgatttcttgaagcaa
tatggtgattttgaaaatggtattcctgttcacgatactattgccagagttgtatcctgt
atcagtcctgcaaaatttcatgagtgctttattaactggatgcgtgactgccattcttca
gatgataaagacgtcatcgcaattgatggaaaaacgctccggcactcttatgacaagagt
cgccgcaggggagcgattcatgtcattagtgcgttctcaacaatgcacagtctggtcatc
ggacagatcaggacggatgagaaatctaatgagattacagctatcccagaacttcttaac
atgctggatattaaaggaaaaatcatcacaactgatgcgatgggttgccagaaagatatt
gcagagaagatacaaaaacagggaggtgattatttattcgcggtaaaaggaaaccagggg
cggctaaataaagcctttgaggaaaaatttccgctgaaagaattaaataatccagagcat
gacagttacgcaatgagtgaaaagagtcacggcagagaagaaatccgtcttcatattgtt
tgcgatgtccctgatgaacttattgatttcacgtttgaatggaaaggactgaagaaatta
tgcgtggcagtctcctttcggtcaataatagcagaacaaaagaaagagccagaaatgacg
gtcagatattatatcagttctgctgatttaaccgcagaaaagttcgccacagcaatccga
aaccactggcacgtggagaataagctgcactggcgtctggacgtggtaatgaatgaagac
gactgcaaaataagaagaggaaacgccgcagaattattttcagggatacggcacatcgct
attaatattttgacgaatgataaggtattcaaggcagggttaagacgtaagatgcgaaaa
gcagctatggacagaaactatctggcgtcagtccttgcggagagcgggctttcgtag

DBGET integrated database retrieval system