KEGG   Escherichia coli O9 HS (commensal): EcHS_A4645
Entry
EcHS_A4645        tRNA      T00591                                 

Definition
(GenBank) tRNA-Thr
  KO
K14234  tRNA Thr
Organism
ecx  Escherichia coli O9 HS (commensal)
Pathway
ecx00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:ecx00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    EcHS_A4645
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:ecx03100]
    EcHS_A4645
Non-coding RNAs [BR:ecx03100]
 Transfer RNA
  EcHS_A4645
SSDB
Position
291741..291816
NT seq 76 nt   +upstreamnt  +downstreamnt
gccgatatagctcagttggtagagcagcgcattcgtaatgcgaaggtcgtaggttcgact
cctattatcggcacca

DBGET integrated database retrieval system