KEGG   Escherichia coli KO11FL: EKO11_0934
Entry
EKO11_0934        gene      T01718                                 

Definition
(GenBank) pseudogene
Organism
eko  Escherichia coli KO11FL
SSDB
Position
976588..977493
NT seq 906 nt   +upstreamnt  +downstreamnt
cgcgctcttaatgtccgactcgctgaacggttcacgatagccgccagactaagtgacagc
cacacggttgtcagcctgtgttctgctctggaaatacaccgcagcagttaccggtactgg
cgaaaacgacgcgatacggttaatccggcacgagtcaggttgtgcagcgaaatacgccgg
gcgtggaaccaaagtcggggctctgcgggcgcgcgcactctggctgaaatgctgactcaa
aacggcgtcccgatgagccgttaccgtgccggacgtctgatgaaatatctgaacctgagc
agttgtcagcccggaaaacatcagtataaaaatgcccgtcaggagcataccagcctgccg
aatctgcttgagcgtcagttcgcagtaccggagccagaccgggtatggtgtggagatatt
acgtatctctgggcaggaaatcgctggtgctatctggcggttgttatggatctttttgcc
cgcagggttatcggctggagtctgtcagcgcatgccgataccgcactgataagcagtgcc
ctgcggatggcctatgagacgcgtggccaaccccgggatgtcgtgttccatagcgaccag
ggaagccagtatacaggccttaaatatcaacaacttctctggcgttgcagaataaatcaa
agcgtcagtcggcggggaaactgctgggataacagccccatggaacgcttcttccgcagt
ctgaaaacagaatgggtgccaacgaatggttacgcaggcaaggacgaggcccggcagcaa
attaatgattacatattgaactactacaacagcgtcagacctcaccattataacggtggg
ctgacgccggaagagtcagagaacagataccatttttactgtaaaaccgtggccaatatt
acttga

DBGET integrated database retrieval system