KEGG   Escherichia coli KO11FL: EKO11_0955
Entry
EKO11_0955        gene      T01718                                 

Definition
(GenBank) pseudogene
Organism
eko  Escherichia coli KO11FL
SSDB
Position
1005402..1006700
NT seq 1299 nt   +upstreamnt  +downstreamnt
atgcgcactatactccgctcgcgttttcatgcaaccttttttttaccccgatcacggatt
tagcatgattttgaacaaaaacaaaccactaaagcctattttttgtgcaaaatttgcgtc
agggagaggctgctcatttcattaaacgcggcggtttgttatcttcgttgcgccttattt
tttaacctgaagaagagaacaatgaaaggacgttgggtaaagtaccttcttatgggcacg
gttgtggcaatgcttgccgcctgctcttccaaaccaaccgatcgcggacagcaatataaa
gacgggaaatttacccagcctttctctctggtgaaccagccagatgccgttggcgcgccg
attaacgccggtgattttgccgagcaaattaaccatatccgtaattcgtcaccgcgtctg
tatggcaaccagagtaatgtttataacgcggtgcaagagtggctgcgcgcaggcggtgat
acccgcaatatgcgccagttcggcattgatgcctggcagatggaaggtgccgacaactat
ggtaacgtgcagtttacaggctattacacgccggtaattcaggcgcgccatacccgccag
ggcgagttccagtatcctatttaccgtatgccgccaaaacgtggtcgtctgccgtctcgt
gcggagatctacgcaggggcgctgagtgataaatatattctcgcttacagcaactccctg
atggataacttcattatggatgtgcagggtagcgggtatatcgactttggtgatggcagt
ccgcttaactttttcagctatgcagggaaaaacggtcatgcctatcgcagcattggtaag
gtgctgatcgaccgtggcgaagtgaaaaaagaagatatgtcgatgcaggcgattcgtcat
tggggcgaaacacacagtgaagccgaggttcgcgagctgctggaacagaacccgtctttc
gttttctttaaaccgcaatcttttgcaccggtgaaaggggcaagtgcggtgccgctggtt
ggccgtgcttctgttgcctccgatcgttcaattattccgccaggtacaaccttgctggca
gaagtgccgctgctggataataacggcaaatttaacggtcagtacgaattgcgtctgatg
gtggcgctggatgtcggtggcgcaatcaaaggccaacacttcgatatctatcaagggatc
gggccggaagccggacaccgcgcaggttggtacaaccactatggacgtgtctgggtgctg
aaaaccgccccgggcgcaggtaacgtctttagtggctga

DBGET integrated database retrieval system