KEGG   Escherichia coli KO11FL: EKO11_0982
Entry
EKO11_0982        gene      T01718                                 

Definition
(GenBank) pseudogene
Organism
eko  Escherichia coli KO11FL
SSDB
Position
complement(1034806..1037562)
NT seq 2757 nt   +upstreamnt  +downstreamnt
atgaccaactacagcctgcgcgcacgcatgatgattctgatcctggcaccgaccgtcctt
attggtttattgctgagtatctttttcgtcgtgcatcgctataacgacttgcagcgtcaa
ctggaagatgccggtgccagcattattgagccgcttgcagtttctactgaatatggcatg
agcctgcaaaatcgcgaatctatcggtcagttaataagcgtactgcatcgtcgccattcc
gatattgttcgcgcgatttcggtttatgatgaaaataaccgactctttgtcacctccaat
tttcatcttgatccctcatcaatgcagctcggcagcaacgtgccgtttcctcgccagctc
actgtcactcgtgacggcgatattatgatcctccgcacgccgattatttctgagagttac
tcccccgacgaatcgcccagtagcgatgccaaaaatagtcaaaatatgttgggatatatt
gcgcttgagctggatcttaaatcggttcgcttgcagcaatataaagagatctttatttcc
agcgtgatgatgctgttttgtatcggtattgcgcttatttttggctggcgcttaatgcgc
gatgtaaccggtccgattcgcaacatggtgaataccgtcgaccgcatccgtcgcgggcaa
ctcgacagccgggtggaaggatttatgctcggcgagctggatatgctgaaaaacggtatc
aactcgatggcaatgtcgctggctgcttatcacgaagagatgcagcacaatatcgaccag
gcgacgtccgatctgcgtgaaacgctggagcagatggaaattcagaacgttgagttagat
ctggcgaaaaagcgcgcccaggaagcggcgcgtattaaatccgagtttctggcaaatatg
tcacacgagctgcgtacaccactgaatggtgttattggctttacccgcctgacgctgaaa
acagaattaacaccaacgcagcgcgatcacctgaatacgattgaacgttcggcaaataat
ttgctggcaattattaatgatgttctcgacttctcgaaactggaagcaggtaagctgatt
ctggaaagtattccattcccactacgcagcacgctggatgaagtcgttactctgctggca
cattcttctcacgataaagggttggaactgacgctcaatattaaaagcgacgtgcctgat
aacgtgatcggcgacccactgcgattacagcaaatcatcactaacctggtggggaatgca
attaaattcaccgagaatggcaacattgatattctggtagaaaaacgtgcgctgagtaat
accaaagtgcagattgaagtgcagattcgggataccggcattggtattcctgaacgcgat
caatcgcgcttattccaggccttccgacaggctgatgccagtatttcccgccgtcatggt
ggcaccggtctggggctggtgattacacaaaaactggttaatgaaatgggcggcgatatt
tcgttccatagccagccgaatcgcggttcaactttctggttccacattaatctcgatctg
aacccgaacattattatcgaagggccatccacccagtgcctcgccggtaagcgcctggcc
tatgtcgaaccaaactccgcagcagcgcaatgcacgctggatattttaagtgaaacgccg
ctggaagtggtttatagcccaacgttctccgcgctgcctcccgcgcattacgacatgatg
ttgttaggcatcgcggtgaccttccgcgagccgctaacaatgcaacatgagcgattagcg
aaagcggtatcgatgaccgatttcctgatgctggcacttccttgccatgcacaagtcaat
gcagaaaaactcaagcaagatggtatcggcgcgtgtctgctgaaaccattaacacctacg
cgcctgttgcctgccctgacggaattttgtcatcacaaacaaaacacgcttttgcctgta
accgatgaaagcaagctggcaatgacagtcatggcagttgatgacaaccccgctaacctg
aaacttatcggcgcattgctggaagatatggtgcaacatgtggaactttgcgatagcggg
catcaggcggttgaacgggcgaaacagatgccgttcgatttgatcttaatggatatttaa
atgcctgacatggatggcattcgggcctgcgagctcatccaccagctcccccatcagcaa
caaacgccggttatcgcggtaacggcgcatgcaatggccgggcaaaaagagaagctgctt
ggcgcagggatgagcgattatctggcgaaaccgattgaagaagagcgattgcataatttg
ttgttgcgctacaagcctggcagcggtatttcctctcgcgtcgtgacgcccgaagtcaac
gaaattgtggtgaacccgaatgcgaccctcgactggcaactggcactacgccaggcagca
ggaaaaaccgatttagcgcgcgatatgctgcaaatgttactcgatttcctgcctgaagtt
cgcaacaaagttgaggaacagctggttggagaaaacccggaaggcctggttgatttgatt
cataaactgcatggcagttgcggctatagcggtgtgccgcgtatgaagaatctctgccaa
ctgatcgaacaacagctacgtagcggtactaaagaagaagatttggagccggagctgctg
gaactgttggacgagatggataatgtagcgcgcgaagccagcaaaattctcgggtaa

DBGET integrated database retrieval system