KEGG   Escherichia coli KO11FL: EKO11_R0017
Entry
EKO11_R0017       tRNA      T01718                                 

Definition
(GenBank) tRNA-Met
  KO
K14230  tRNA Met
Organism
eko  Escherichia coli KO11FL
Pathway
eko00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:eko00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    EKO11_R0017
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:eko03100]
    EKO11_R0017
Non-coding RNAs [BR:eko03100]
 Transfer RNA
  EKO11_R0017
SSDB
Position
complement(1005318..1005394)
NT seq 77 nt   +upstreamnt  +downstreamnt
cgcggggtggagcagcctggtagctcgtcgggctcataacccgaaggtcgtcggttcaaa
tccggcccccgcaacca

DBGET integrated database retrieval system