KEGG   Escherichia coli O83 H1 NRG 857C: NRG857_t22395Help
Entry
NRG857_t22395     tRNA      T02068                                 

Definition
(RefSeq) tRNA-Pro
  KO
K14232  tRNA Pro
Organism
eln  Escherichia coli O83:H1 NRG 857C
Pathway
eln00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:eln00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    NRG857_t22395
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:eln03100]
    NRG857_t22395
Non-coding RNAs [BR:eln03100]
 Transfer RNA
  tRNA
   NRG857_t22395
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 12876567
Position
complement(3728713..3728789)
Genome map
NT seq 77 nt NT seq  +upstreamnt  +downstreamnt
cggtgattggcgcagcctggtagcgcacttcgttcgggacgaaggggtcggaggttcgaa
tcctctatcaccgacca

DBGET integrated database retrieval system