KEGG   Escherichia coli NA114 (UPEC): ECNA114_t43
Entry
ECNA114_t43       tRNA      T01998                                 

Definition
(GenBank) tRNA-Gly
  KO
K14225  tRNA Gly
Organism
ena  Escherichia coli NA114 (UPEC)
Pathway
ena00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:ena00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    ECNA114_t43
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:ena03100]
    ECNA114_t43
Non-coding RNAs [BR:ena03100]
 Transfer RNA
  ECNA114_t43
SSDB
Position
complement(2984465..2984539)
NT seq 75 nt   +upstreamnt  +downstreamnt
gcgggcgtagttcaatggtagaacgagagcttcccaagctctatacgagggttcgattcc
cttcgcccgctccaa

DBGET integrated database retrieval system