KEGG   Enterobacter cloacae subsp. cloacae ATCC 13047: ECL_01912Help
Entry
ECL_01912         CDS       T01231                                 

Definition
(RefSeq) biofilm-dependent modulation protein
Organism
enc  Enterobacter cloacae subsp. cloacae ATCC 13047
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: BDM YmgB
Motif
Other DBs
NCBI-GeneID: 9124409
NCBI-ProteinID: YP_003612415
UniProt: A0A0H3CJI4
Position
complement(1946480..1946695)
Genome map
AA seq 71 aa AA seqDB search
MFTYYPANTAAAQPELVNAIAQGLHAEHGAVTEDDILMELTKWVESTDNDILSDIYQQTI
NYVVSGQNAPL
NT seq 216 nt NT seq  +upstreamnt  +downstreamnt
atgtttacttattacccggccaatactgcagcagcacaacctgaactcgttaacgcgatt
gcacaaggtcttcacgccgagcatggtgctgtgactgaagatgacattttgatggaactg
accaagtgggtggaatccacagacaatgacatcctcagtgacatctaccagcagaccatt
aactacgtcgtcagcgggcaaaacgcacctttgtaa

DBGET integrated database retrieval system