KEGG   Enterobacter lignolyticus SCF1: Entcl_3522Help
Entry
Entcl_3522        gene      T01342                                 

Definition
(GenBank) pseudogene
Organism
esc  Enterobacter lignolyticus SCF1
SSDB OrthologParalogGene clusterGFIT
Position
3772642..3772752
Genome map
NT seq 111 nt NT seq  +upstreamnt  +downstreamnt
gactcgcatatcaaagatctgcgcactgatgcagagttccgcaatacccaggccgtgctg
gacggcagcctggaccaatttatcgaagcaagtttgaaagcagggttatga

DBGET integrated database retrieval system