KEGG   Enterobacter lignolyticus SCF1: Entcl_3524Help
Entry
Entcl_3524        gene      T01342                                 

Definition
(GenBank) pseudogene
Organism
esc  Enterobacter lignolyticus SCF1
SSDB OrthologParalogGene clusterGFIT
Position
complement(3774285..3774389)
Genome map
NT seq 105 nt NT seq  +upstreamnt  +downstreamnt
ttgccaaaacctgatgcgcgagcggcgctgcaaaacctggcggtaccgttcaactattac
aatgaaaaccatatgcatagtgcactggaatagcgctccccgagg

DBGET integrated database retrieval system