KEGG   Enterobacter lignolyticus SCF1: Entcl_R0069Help
Entry
Entcl_R0069       rRNA      T01342                                 

Definition
(GenBank) 5S ribosomal RNA
  KO
K01985  5S ribosomal RNA
Organism
esc  Enterobacter lignolyticus SCF1
Pathway
esc03010  Ribosome
Brite
KEGG Orthology (KO) [BR:esc00001]
 09120 Genetic Information Processing
  09122 Translation
   03010 Ribosome
    Entcl_R0069
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03011 Ribosome [BR:esc03011]
    Entcl_R0069
  09184 RNA family
   03100 Non-coding RNAs [BR:esc03100]
    Entcl_R0069
Ribosome [BR:esc03011]
 Ribosomal RNAs
  Prokaryotes
   Entcl_R0069
Non-coding RNAs [BR:esc03100]
 Ribosomal RNA
  Large subunit rRNA
   Entcl_R0069
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
complement(3784164..3784279)
Genome map
NT seq 116 nt NT seq  +upstreamnt  +downstreamnt
cctggcggcaaaagcgcggtggtcccacctgaccccatgccgaactcagaagtgaaacgc
cgtagcgccgatggtagtgtggggtctccccatgtgagagtagggaactgccaggc

DBGET integrated database retrieval system