KEGG   Enterobacter lignolyticus SCF1: Entcl_R0072Help
Entry
Entcl_R0072       tRNA      T01342                                 

Definition
(GenBank) tRNA-Ile
  KO
K14227  tRNA Ile
Organism
esc  Enterobacter lignolyticus SCF1
Pathway
esc00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:esc00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    Entcl_R0072
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:esc03100]
    Entcl_R0072
Non-coding RNAs [BR:esc03100]
 Transfer RNA
  tRNA
   Entcl_R0072
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
complement(3787543..3787619)
Genome map
NT seq 77 nt NT seq  +upstreamnt  +downstreamnt
aggcttgtagctcaggtggttagagcgcacccctgataagggtgaggtcggtggttcaag
tccactcaggcctacca

DBGET integrated database retrieval system