KEGG   Francisella tularensis subsp. tularensis TIGB03: FTU_1372Help
Entry
FTU_1372          CDS       T01762                                 

Definition
(GenBank) hypothetical protein
Organism
ftg  Francisella tularensis subsp. tularensis TIGB03
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: DUF2345 Sarcoglycan_1 ITI_HC_C STT3_PglB_C
Motif
Other DBs
NCBI-ProteinID: AFB79392
Position
1461803..1462297
Genome map
AA seq 164 aa AA seqDB search
MSKADHIFNLEEQGLLIDIKDDSKGCTTKLESSGKITHNATESIESSADKQIIENVKDSK
ISITEKEILLATKKSSIMLSEDKIVIKIGNSLIILDDSNISLESATINIKSSANINIQAS
QNIDIKSLNNSIKADVNLNAEGLDVNIKGSVTASIKGSTATMVG
NT seq 495 nt NT seq  +upstreamnt  +downstreamnt
atgtcaaaagcagaccatattttcaacttagaagagcaaggcttgctcatagatatcaaa
gatgattcaaaaggctgcactacgaaactagagtcctctggaaaaatcactcataatgca
actgaatcgatagagtcaagcgctgataaacaaataattgaaaatgtcaaagactcaaaa
atatcaataactgaaaaagaaattttgttagctactaagaaatcaagcattatgcttagt
gaagataaaattgtcataaaaataggtaattctttaattatacttgatgattcaaatatt
tcgctagagtctgcaactattaatataaaaagctctgctaatataaatattcaagcatca
cagaacatagatataaaaagtctaaataatagtatcaaagcagatgtaaaccttaatgct
gaagggttagatgtaaatattaaaggaagtgtaacagcaagcataaaaggttctacagca
acaatggttggataa

DBGET integrated database retrieval system