KEGG   Francisella tularensis subsp. tularensis SCHU S4: FTT_0662cHelp
Entry
FTT_0662c         gene      T00214                                 

Definition
(RefSeq) pseudogene
Organism
ftu  Francisella tularensis subsp. tularensis SCHU S4
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 3191058
Position
complement(680648..681107)
Genome map
NT seq 460 nt NT seq  +upstreamnt  +downstreamnt
atgaatagacaagatatagataaggcattagctaagtggaaaaatggcttattaaagatt
tctaaaacttatagggaaggaggagactataagcaattagctcacgattttatcaaagat
atgtatgcttatgataatagtgaagttctttttaagccaactctagcatctaataaaatg
tttagaggcgacttagaaggtgcagtatcttattttgttgcaggcaatgataaataccct
gaagataatggttttgctatcggaccatgggcagatctagaatttgaaaatgccggctat
atcgttgaagacaatattggtatagttatgtaacaaacatttaactcaaactaatggtaa
caaagtagttgcaaactatacaatgggtttcaaacctaatgctaatggtgaactacaaat
cgtacttcatcattcatctttaccgtatactccagtataa

DBGET integrated database retrieval system