KEGG   Francisella tularensis subsp. tularensis SCHU S4: FTT_0706Help
Entry
FTT_0706          gene      T00214                                 

Gene name
glk2
Definition
(RefSeq) pseudogene
Organism
ftu  Francisella tularensis subsp. tularensis SCHU S4
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 3190972
Position
724462..725393
Genome map
NT seq 932 nt NT seq  +upstreamnt  +downstreamnt
atgtacataggtttagatattggcggtagtaatatctctgctggtatttttgatgagcaa
aagaaccttattaaaactgcaaaggttaaatcaaaaggcaaaagtgatgctgatgtaatt
ctagcgcagattttcaaagtgattaataaactacttgatagttcaaataaaaataagata
aaagctataggtattggcattgctagttttgttgattcaaaatcaggtgtcttaaatttc
agtgctaatatcaaccttaatggtataaatattgctcaagaagtcagccaaaaatttgca
aatgtaccagtatttatcgaaaatgatgtaaatgtgggtgttattggtgaatggaaatat
ggtgctggtagaagccatcaaaatattgttggtatatttgcaggcactggtattggtggc
ggtcttgtggtaaataatcagtttttgtatggagttacaggaggtgcaggcgcagttggg
catgtgactattaatagtcaaggagcttattgtcagagctgtggttcacaaggatgttta
gaagcctatgctggtaaagttggtattgaaaagaaaatagaaaatttagcgaagaaaaat
attcatagcactttgattgatcttgtaatggagaatggtggtaaactaaagagtagtcat
attaaaaaagcactagatgatcaagatgaaattgctatggatatactcagtgaagctatg
gaatatctgggtacaggtttaggaagcgctttaaatatgataaattaggtggtggtgtta
tggaagctattggtgaaaggtaccttgcccagataaaaagagcagcaatgaaaaattcat
ttgccgatatttatgcagaatgtgactttaagctagctaaacttggagatcaagcaggta
tttatggagctatggagctagttgctggttaa

DBGET integrated database retrieval system