KEGG   Francisella tularensis subsp. tularensis SCHU S4: FTT_0717Help
Entry
FTT_0717          gene      T00214                                 

Gene name
purU
Definition
(RefSeq) pseudogene
Organism
ftu  Francisella tularensis subsp. tularensis SCHU S4
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 3191661
Position
737240..738072
Genome map
NT seq 833 nt NT seq  +upstreamnt  +downstreamnt
atgcaaaaatatagattactaatagaaactgatgatcaaaaaggattagtttataaagtt
tcaaaaattatttttgaaaataatcttaatgttgaaagaaactcagagttcgttgataaa
cagcataataagttttttatgcgtactgttttttcaggtgaggtgaatattcaactgatg
ttgtctgaccttactgagactctactaactaaatcacaaatcaaattagttgattcatct
aaaaaaatattgttattttagctacaaaggaaatgcattgccttggagatttactaataa
aacatactgaaggtaagttagatgcaaatattactgcagtaatttcaaactatgataatc
ttagaggcttagttgagaagtttgatataccttttgagcatgtttctcatgaaggaatta
ctagagaagagcatgagagtagagtttgtgatattataaaaacttaccaacatgatgtta
ttgtacttgcaaagtatatgcgaatattatcgccaaactttgtaaaacaatttcagggta
agctattaaatattcatcattcatttttaccagcatttattggggcaaatccatataagc
aagcatatgagagaggggtgaaaataattggcgcaactagtcactttgtcacagatgatt
tagatgaaggaccaattatagctcaggatataattagggttgatcatagctactcatggc
aagctatgcgtgatgcaggtcatgatgttgagaaaaatgttctatcaacggctctaaatt
tagtacttaaagataaagtttttgtttataacaataagacagtaattttgtaa

DBGET integrated database retrieval system