KEGG   Francisella tularensis subsp. tularensis SCHU S4: FTT_t10Help
Entry
FTT_t10           tRNA      T00214                                 

Definition
(RefSeq) tRNA-Ser
  KO
K14233  tRNA Ser
Organism
ftu  Francisella tularensis subsp. tularensis SCHU S4
Pathway
ftu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:ftu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    FTT_t10
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:ftu03100]
    FTT_t10
Non-coding RNAs [BR:ftu03100]
 Transfer RNA
  tRNA
   FTT_t10
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 3192276
Position
complement(774956..775040)
Genome map
NT seq 85 nt NT seq  +upstreamnt  +downstreamnt
tggagaaatggctgagtggtcgaaagcggcggtcttgaaaaccgttgactgtaacaggtc
cgggggttcgaatccctctttctcc

DBGET integrated database retrieval system