KEGG   Gemmatimonas aurantiaca: GAU_3881Help
Entry
GAU_3881          CDS       T00878                                 

Definition
(GenBank) hypothetical protein
Organism
gau  Gemmatimonas aurantiaca
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: PAAR_motif DUF4150
Motif
Other DBs
NCBI-ProteinID: BAH40923
NITE: GAU_3881
UniProt: C1AEJ6
Position
4577665..4577964
Genome map
AA seq 99 aa AA seqDB search
MPPASRITDMHVCPMMTPGVPPIPHVGGPIVVPGAPTVLIAMLPAATLGSMCVCVGPPSS
VIKGSATVLMGSKPAARMGDNTAHGGVIVLGAPTVMVGG
NT seq 300 nt NT seq  +upstreamnt  +downstreamnt
atgcctccagcgtcacgcatcacggacatgcatgtctgtccgatgatgacccccggcgtt
ccacccattccgcatgtcggcgggccgatcgtggtgcccggcgcaccaacggtgctgatc
gccatgctgcccgctgccacactcggcagtatgtgtgtgtgcgtcggaccgccgtcgtcc
gtcatcaaaggatcggccacggtgctcatgggcagcaagccggccgcacgcatgggcgac
aatacggcacacgggggcgtcattgtcctcggcgcacccacggtgatggtgggcggctga

DBGET integrated database retrieval system