KEGG   Candidatus Gullanella endobia (Ferrisia virgata): FVIR_GE00513
Entry
FVIR_GE00513      tRNA      T04502                                 

Definition
(GenBank) tRNA-Leu
  KO
K14228  tRNA Leu
Organism
ged  Candidatus Gullanella endobia (Ferrisia virgata)
Pathway
ged00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:ged00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    FVIR_GE00513
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:ged03100]
    FVIR_GE00513
Non-coding RNAs [BR:ged03100]
 Transfer RNA
  FVIR_GE00513
SSDB
Position
I:complement(908221..908303)
NT seq 83 nt   +upstreamnt  +downstreamnt
acgggagtggcgaaattggtagacgcaccagatttaggttctggcgccgtaaggtttgcg
agttcaagtctcgcctcccgtac

DBGET integrated database retrieval system