KEGG   Candidatus Gullanella endobia (Ferrisia virgata): FVIR_GE00525
Entry
FVIR_GE00525      tmRNA     T04502                                 

Gene name
ssrA
Definition
(GenBank) transfer-messenger RNA, SsrA
  KO
K15035  transfer-messenger RNA
Organism
ged  Candidatus Gullanella endobia (Ferrisia virgata)
Brite
KEGG Orthology (KO) [BR:ged00001]
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:ged03100]
    FVIR_GE00525 (ssrA)
Non-coding RNAs [BR:ged03100]
 Other RNA
  Unclassified
   FVIR_GE00525 (ssrA)
SSDB
Position
I:complement(930562..930944)
NT seq 383 nt   +upstreamnt  +downstreamnt
ggggctgattatggacttgacgggatttacgaaacctaaaagcgcatgccgaggtaaggt
tgcctcgtaaaaaaccttaaaaaaataattgcaaacaatccgcaatttgaatctaatgct
gctttagcagcttaatcagtttaataaactgaagattccctctctccctagcctccgctc
ttaggacggggatcaagagaggtcaaaataaagagagatcgcgtgaatgcactgcctagt
gctaaagcgttaaaactaatcaggctagtttgctagcagtctgttcgtcttacagctagc
aggtgaataaaaaagactgaactaagcatgtagtactgaaggtgtagaagtttcggacgc
gggttcaaatcccgccagctcca

DBGET integrated database retrieval system